Feature RNA_hairpin_3747
Name
RNA_hairpin_3747
Location
115190..115227 +
Type
RNA_hairpin
Sequence
CCACCTCGTCTTTGCGGCCTTTAAAGCGGGCGCGGTGG
Energy (kcal/mol)
-15.3419
Secondary Structure
View
 MyGBrowser