Feature RNA_hairpin_3746
Name
RNA_hairpin_3746
Location
115052..115074 +
Type
RNA_hairpin
Sequence
CGACAAGCAGAAGCAGTTTGTCG
Energy (kcal/mol)
-9.20946
Secondary Structure
View
 MyGBrowser