Feature RNA_hairpin_3745
Name
RNA_hairpin_3745
Location
114961..114982 +
Type
RNA_hairpin
Sequence
CGGTACCGAGTTTGTGGTATTG
Energy (kcal/mol)
-8.92042
Secondary Structure
View
 MyGBrowser