Feature RNA_hairpin_3744
Name
RNA_hairpin_3744
Location
114470..114499 +
Type
RNA_hairpin
Sequence
CCGGTGTCGAACCCCTCGATTCGACCAAGG
Energy (kcal/mol)
-12.7204
Secondary Structure
View
 MyGBrowser