Feature RNA_hairpin_3743
Name
RNA_hairpin_3743
Location
114275..114322 +
Type
RNA_hairpin
Sequence
CCCGTGACCCCTTACACGCCCAATGCGGGGTTAGCCCGGGTGAATGGG
Energy (kcal/mol)
-19.883
Secondary Structure
View
 MyGBrowser