Feature RNA_hairpin_3710
Name
RNA_hairpin_3710
Location
88382..88408 +
Type
RNA_hairpin
Sequence
GTGGTGCTTTAATTGTGAAAGCACTAT
Energy (kcal/mol)
-11.2095
Secondary Structure
View
 MyGBrowser