Feature RNA_hairpin_3708
Name
RNA_hairpin_3708
Location
88113..88132 +
Type
RNA_hairpin
Sequence
TCACCCGTTTGAAGGGGTGG
Energy (kcal/mol)
-10.2204
Secondary Structure
View
 MyGBrowser