Feature RNA_hairpin_3706
Name
RNA_hairpin_3706
Location
87615..87641 +
Type
RNA_hairpin
Sequence
TTGCCGTGCATAACCATAGTACGGCAA
Energy (kcal/mol)
-13.2
Secondary Structure
View
 MyGBrowser