Feature RNA_hairpin_3705
Name
RNA_hairpin_3705
Location
87536..87555 +
Type
RNA_hairpin
Sequence
CGCGGCTCACCCCAGCCGTG
Energy (kcal/mol)
-10.2204
Secondary Structure
View
 MyGBrowser