Feature RNA_hairpin_3681
Name
RNA_hairpin_3681
Location
76867..76886 +
Type
RNA_hairpin
Sequence
GTCGTTGGGGGCCCGATGGC
Energy (kcal/mol)
-11.4
Secondary Structure
View
 MyGBrowser