Feature RNA_hairpin_3680
Name
RNA_hairpin_3680
Location
76857..76880 +
Type
RNA_hairpin
Sequence
GGGTTCGTTTGTCGTTGGGGGCCC
Energy (kcal/mol)
-9.79075
Secondary Structure
View
 MyGBrowser