Feature RNA_hairpin_3665
Name
RNA_hairpin_3665
Location
67192..67221 +
Type
RNA_hairpin
Sequence
TATGACACTTCTAATTCTGGTGGTGTCGTA
Energy (kcal/mol)
-12.5
Secondary Structure
View
 MyGBrowser