Feature RNA_hairpin_3664
Name
RNA_hairpin_3664
Location
67114..67149 +
Type
RNA_hairpin
Sequence
AGCAACAAGCCAATCCCCAAGGAAAAGCTTGTTGCT
Energy (kcal/mol)
-19.5
Secondary Structure
View
 MyGBrowser