Feature RNA_hairpin_3663
Name
RNA_hairpin_3663
Location
66971..66992 +
Type
RNA_hairpin
Sequence
CTTAATGTCTTTAGGCATTAAG
Energy (kcal/mol)
-9.8
Secondary Structure
View
 MyGBrowser