Feature RNA_hairpin_3630
Name
RNA_hairpin_3630
Location
40209..40245 +
Type
RNA_hairpin
Sequence
GGGGTTTCAATCGGGGAAATTTCCTTAATGATACCCT
Energy (kcal/mol)
-15.3
Secondary Structure
View
 MyGBrowser