Feature RNA_hairpin_3628
Name
RNA_hairpin_3628
Location
40048..40070 +
Type
RNA_hairpin
Sequence
TGTTGTCCTTGTCAGTGACAGCA
Energy (kcal/mol)
-9.8
Secondary Structure
View
 MyGBrowser