Feature RNA_hairpin_3626
Name
RNA_hairpin_3626
Location
39339..39360 +
Type
RNA_hairpin
Sequence
AGCAGTTCAAAGTGGCACTGCT
Energy (kcal/mol)
-9.12213
Secondary Structure
View
 MyGBrowser