Feature RNA_hairpin_3624
Name
RNA_hairpin_3624
Location
39042..39078 +
Type
RNA_hairpin
Sequence
TCCCTGATGGTGTAACCAGCATAAGCACCAGGTGGGG
Energy (kcal/mol)
-16.8919
Secondary Structure
View
 MyGBrowser