Feature RNA_hairpin_3619
Name
RNA_hairpin_3619
Location
32136..32165 +
Type
RNA_hairpin
Sequence
GGGCCTGGTCCGTTTAAGAGGGCAAGGCTT
Energy (kcal/mol)
-16.3204
Secondary Structure
View
 MyGBrowser