Feature RNA_hairpin_3617
Name
RNA_hairpin_3617
Location
31129..31157 +
Type
RNA_hairpin
Sequence
GTTGGTTTACCCAACGTTGGTAAATCAAC
Energy (kcal/mol)
-13.8095
Secondary Structure
View
 MyGBrowser