Feature DNA_hairpin_3531
Name
DNA_hairpin_3531
Location
29783..29805 -
Type
DNA_hairpin
Sequence
ATTAAATTCTAATCTAATTTAAT
Energy (kcal/mol)
-10.5
View
 MyGBrowser