Feature DNA_hairpin_3507
Name
DNA_hairpin_3507
Location
67693..67721 -
Type
DNA_hairpin
Sequence
ACCATTTTCTAAGGCTCTTAGAAAATGGT
Energy (kcal/mol)
-18
View
 MyGBrowser