Feature DNA_hairpin_3495
Name
DNA_hairpin_3495
Location
83320..83347 -
Type
DNA_hairpin
Sequence
TTTCAAGCATGATGGCCGCTGCTTGAAA
Energy (kcal/mol)
-12
View
 MyGBrowser