Feature DNA_hairpin_3491
Name
DNA_hairpin_3491
Location
88385..88405 -
Type
DNA_hairpin
Sequence
GTGCTTTCACAATTAAAGCAC
Energy (kcal/mol)
-9
View
 MyGBrowser