Feature DNA_hairpin_3467
Name
DNA_hairpin_3467
Location
111348..111373 -
Type
DNA_hairpin
Sequence
AAAATAAATAACTTACTGTTTATTTT
Energy (kcal/mol)
-10.5
View
 MyGBrowser