Feature DNA_hairpin_3463
Name
DNA_hairpin_3463
Location
115890..115912 -
Type
DNA_hairpin
Sequence
AAACTAACAGCTTTTGTTAGTTT
Energy (kcal/mol)
-12
View
 MyGBrowser