Feature DNA_hairpin_3121
Name
DNA_hairpin_3121
Location
469136..469165 -
Type
DNA_hairpin
Sequence
TAAGGCGAAATTTCTCTAAATTTCGTTTTA
Energy (kcal/mol)
-13.5
View
 MyGBrowser