Feature PRIBNOW_28
Name
PRIBNOW_28
Location
75174..75211 +
Type
PRIBNOW
Sequence
ACCAATTACCCCATTACAAAGGAGTAATTTAACATTAT
View
 MyGBrowser