Feature DNA_hairpin_2463
Name
DNA_hairpin_2463
Location
469141..469160 +
Type
DNA_hairpin
Sequence
CGAAATTTAGAGAAATTTCG
Energy (kcal/mol)
-10.5
View
 MyGBrowser