Feature DNA_hairpin_2175
Name
DNA_hairpin_2175
Location
162022..162043 +
Type
DNA_hairpin
Sequence
TCATTTTGAAAAATGAAAATGA
Energy (kcal/mol)
-9
View
 MyGBrowser