Feature DNA_hairpin_2137
Name
DNA_hairpin_2137
Location
126972..126993 +
Type
DNA_hairpin
Sequence
TTGGTATCCATACTAATACCAA
Energy (kcal/mol)
-9
View
 MyGBrowser