Feature DNA_hairpin_2127
Name
DNA_hairpin_2127
Location
115890..115912 +
Type
DNA_hairpin
Sequence
AAACTAACAAAAGCTGTTAGTTT
Energy (kcal/mol)
-12
View
 MyGBrowser