Feature DNA_hairpin_2119
Name
DNA_hairpin_2119
Location
108892..108912 +
Type
DNA_hairpin
Sequence
TTTTTGTGTAAAAAACAAAAA
Energy (kcal/mol)
-9
View
 MyGBrowser