Feature DNA_hairpin_2100
Name
DNA_hairpin_2100
Location
88475..88499 +
Type
DNA_hairpin
Sequence
TTGATAATACTAGGCAAATTATCAA
Energy (kcal/mol)
-10.5
View
 MyGBrowser