Feature DNA_hairpin_2097
Name
DNA_hairpin_2097
Location
84577..84598 +
Type
DNA_hairpin
Sequence
CAAAGCTTTTACCTTAGCTTTG
Energy (kcal/mol)
-9
View
 MyGBrowser