Feature DNA_hairpin_2090
Name
DNA_hairpin_2090
Location
72327..72347 +
Type
DNA_hairpin
Sequence
TTACTTTTTATCACAAAGTAA
Energy (kcal/mol)
-9
View
 MyGBrowser