Feature DNA_hairpin_2080
Name
DNA_hairpin_2080
Location
66971..66992 +
Type
DNA_hairpin
Sequence
CTTAATGTCTTTAGGCATTAAG
Energy (kcal/mol)
-9
View
 MyGBrowser