Feature PRIBNOW_1152
Name
PRIBNOW_1152
Location
469316..469355 -
Type
PRIBNOW
Sequence
TCAAGCCATTTGAAATAAGTTTGGGGTTTGTTAGAATAAT
View
 MyGBrowser