Feature PRIBNOW_1137
Name
PRIBNOW_1137
Location
424237..424276 -
Type
PRIBNOW
Sequence
GTGCGCCAAAAGCTAATTAAAAAAGGTTTGTTATAGTAAT
View
 MyGBrowser