Feature PRIBNOW_1044
Name
PRIBNOW_1044
Location
126567..126606 -
Type
PRIBNOW
Sequence
TCATTAGGAATTGATGTTTTATAAAGGAAAATAGTCTTAC
View
 MyGBrowser