Feature PRIBNOW_1043
Name
PRIBNOW_1043
Location
125324..125363 -
Type
PRIBNOW
Sequence
GGGCTAACACCGACACTAAATCAGGGTAGTTTAGAATCAT
View
 MyGBrowser