Feature PRIBNOW_1033
Name
PRIBNOW_1033
Location
110279..110318 -
Type
PRIBNOW
Sequence
AAAAACTAAAATTCTGTTTTAATAACAATTTTTAAATTAT
View
 MyGBrowser