Feature PRIBNOW_1023
Name
PRIBNOW_1023
Location
87998..88037 -
Type
PRIBNOW
Sequence
CACTTAAAGTGTTCTTTAAAAATGGCAAAATTAAAATGGA
View
 MyGBrowser