Feature PRIBNOW_1022
Name
PRIBNOW_1022
Location
86493..86532 -
Type
PRIBNOW
Sequence
AAAAGTAAACGGTTAGCGTTGTGTAACAAACTACACTTAA
View
 MyGBrowser