Feature PRIBNOW_1008
Name
PRIBNOW_1008
Location
66803..66842 -
Type
PRIBNOW
Sequence
GACTACTTGAATCTTCTTCATATCAGCCGAGTATTATTTT
View
 MyGBrowser