Feature PRIBNOW_1007
Name
PRIBNOW_1007
Location
65552..65591 -
Type
PRIBNOW
Sequence
GCATCACTTAAATGGGTGTAAATCACCTCATTAAAATAAG
View
 MyGBrowser